CRISPRi-mediated knockdown ofmsmeg_6073reveals condition-dependent growth andmorphological phenotypes inMycobacteriumsmegmatis
Background: Tuberculosis remains a major global health challenge, highlighting the need for new therapeutic targets.Mycobacteria can adapt to environmental stress and antibiotic exposure through a potential mechanism calledepitranscriptomic regulation, mainly RNA methylation. Objectives: This study investigates msmeg_6073, the Mycobacterium smegmatis ortholog of the essential Mycobacteriumtuberculosis gene rv3579c, predicted to encode a 23S rRNA 22 -O-methyltransferase involved in ribosomal RNA modification.Methods: Using an anhydrotetracycline (ATc)-inducible CRISPR interference (CRISPRi) system, knockdown strains targetingmsmeg_6073 were constructed. Among designed guide RNAs, guide 1 (5’GGGAAGGCCGCGCCTGCGCACACCG 3’)showed the most consistent functional activity. RT-qPCR analysis confirmed transcriptional repression of msmeg_6073under 50 ng/mL ATc induction conditions. Expression analysis of the upstream gene msmeg_6074 ( cysS ) was also conductedto evaluate target specificity. Phenotypic analysis included ATc-inducible drop assays and liquid culture growth curveanalysis. Results:RT-qPCR analysis confirmed effective transcriptional repression of msmeg_6073 under induced conditions.Furthermore, expression analysis of msmeg_6074 ( cysS) showed no significant transcriptional changes, indicating target-specific repression without upstream gene effects. Phenotypic analysis showed growth inhibition on solid media followingmsmeg_6073 repression, whereas no significant growth defects were observed in liquid culture. These findings suggestthat msmeg_6073 repression may be condition dependent. Conclusion: This study provides a validated CRISPRi workflow for inducible repression of msmeg_6073 in M. smegmatis.Future RNA methylation and MIC analyses may help clarify the role of msmeg_6073 in ribosome-associated processes andsusceptibility to ribosome-targeting antibiotics, improving understanding of the mycobacterial epitranscriptome and itspotential relevance to future therapeutic strategies.