Skip to content

Author

Suwatchareeporn Rotcheewaphan

1 paper indexed here

We haven’t gathered this author’s papers yet. Follow them and we’ll fetch their work.

Not the right person? Other researchers publish under this name.

Open access 2026

CRISPRi-mediated knockdown ofmsmeg_6073reveals condition-dependent growth andmorphological phenotypes inMycobacteriumsmegmatis

Background: Tuberculosis remains a major global health challenge, highlighting the need for new therapeutic targets.Mycobacteria can adapt to environmental stress and antibiotic exposure through a potential mechanism calledepitranscriptomic regulation, mainly RNA methylation. Objectives: This study investigates msmeg_6073, the Mycobacterium smegmatis ortholog of the essential Mycobacteriumtuberculosis gene rv3579c, predicted to encode a 23S rRNA 22 -O-methyltransferase involved in ribosomal RNA modification.Methods: Using an anhydrotetracycline (ATc)-inducible CRISPR interference (CRISPRi) system, knockdown strains targetingmsmeg_6073 were constructed. Among designed guide RNAs, guide 1 (5’GGGAAGGCCGCGCCTGCGCACACCG 3’)showed the most consistent functional activity. RT-qPCR analysis confirmed transcriptional repression of msmeg_6073under 50 ng/mL ATc induction conditions. Expression analysis of the upstream gene msmeg_6074 ( cysS ) was also conductedto evaluate target specificity. Phenotypic analysis included ATc-inducible drop assays and liquid culture growth curveanalysis. Results:RT-qPCR analysis confirmed effective transcriptional repression of msmeg_6073 under induced conditions.Furthermore, expression analysis of msmeg_6074 ( cysS) showed no significant transcriptional changes, indicating target-specific repression without upstream gene effects. Phenotypic analysis showed growth inhibition on solid media followingmsmeg_6073 repression, whereas no significant growth defects were observed in liquid culture. These findings suggestthat msmeg_6073 repression may be condition dependent. Conclusion: This study provides a validated CRISPRi workflow for inducible repression of msmeg_6073 in M. smegmatis.Future RNA methylation and MIC analyses may help clarify the role of msmeg_6073 in ribosome-associated processes andsusceptibility to ribosome-targeting antibiotics, improving understanding of the mycobacterial epitranscriptome and itspotential relevance to future therapeutic strategies.

Ali Aadel Karimpour, Suwatchareeporn Rotcheewaphan, Pornchai Kaewsapsak · 0 citations