A specific protein (SRSF2) acts like a rogue editor, altering the genetic instructions of another molecule (hnRNPD) and creates a “shield” (PD-L1) on the surface of the cancer cell, effectively blinding the immune system and allowing the tumor to grow unchecked.
Abstract
Gallbladder cancer (GBC), a lethal malignancy of the biliary tract, is associated with a poor clinical prognosis. Although chemo-immunotherapy combinations demonstrate preliminary efficacy, the molecular determinants of treatment response remain elusive. Emerging evidence implicates aberrant alternative splicing in modulating tumor immunity. Through an in vitro CRISPR/Cas9 screen, we identified SRSF2 as a key RNA-binding protein regulating PD-L1 expression. Intriguingly, SRSF2 does not directly bind PD-L1 mRNA. Multi-omics analyses (mRNA-seq, RIP-seq, and proteomics) revealed that SRSF2 induces exon skipping in hnRNPD, shifting isoform expression from full-length P45 to truncated P40. Functional studies established that P45—but not P40—binds to AU-rich elements in the PD-L1 3’-UTR to promote mRNA degradation. Leveraging this mechanism, we designed splice-switching antisense oligonucleotides (ASOs) that block SRSF2-mediated exon skipping, restoring P45 expression. This intervention effectively reduced PD-L1 levels and potentiated T-cell-mediated cytotoxicity in vitro and in vivo. These findings elucidate a splicing-centric mechanism of immune evasion and highlight the therapeutic potential of splicing modulation in cancer immunotherapy. Proposed model of the SRSF2-hnRNPD-PD-L1 axis in gallbladder cancer (GBC) immune evasion and its therapeutic targeting. Overexpression of SRSF2 drives hnRNPD exon skipping, shifting the isoform balance from the PD-L1-degrading P45 to the truncated P40. This transition stabilizes PD-L1 mRNA and facilitates tumor immune evasion. Conversely, therapeutic intervention with splice-switching ASOs blocks SRSF2-mediated alternative splicing, restores P45 expression, and effectively reactivates T-cell-mediated cytotoxicity against GBC cells. Proposed model of the SRSF2-hnRNPD-PD-L1 axis in gallbladder cancer (GBC) immune evasion and its therapeutic targeting. Overexpression of SRSF2 drives hnRNPD exon skipping, shifting the isoform balance from the PD-L1-degrading P45 to the truncated P40. This transition stabilizes PD-L1 mRNA and facilitates tumor immune evasion. Conversely, therapeutic intervention with splice-switching ASOs blocks SRSF2-mediated alternative splicing, restores P45 expression, and effectively reactivates T-cell-mediated cytotoxicity against GBC cells. Gallbladder cancer is a highly aggressive disease that often evades the body’s natural immune defense, making current treatments less effective. Our study aimed to understand the hidden mechanisms allowing these cancer cells to hide from immune attacks. Using laboratory tumor models and patient tissue samples, we investigated the internal genetic processes of these cancer cells. We discovered that a specific protein (SRSF2) acts like a rogue editor, altering the genetic instructions of another molecule (hnRNPD). This specific modification ultimately creates a “shield” (PD-L1) on the surface of the cancer cell, effectively blinding the immune system and allowing the tumor to grow unchecked. Understanding this specific genetic editing process is highly significant, as it provides a vital new target. In the future, blocking this pathway could strip away the cancer’s shield, potentially making existing immunotherapies much more effective for patients.
ABSTRACT Objective Circular RNAs (circRNAs) represent key regulators in cancer pathogenesis; however, their involvement in alternative splicing (AS) remains poorly understood. Methods Expression of circFut8 was detected in bladder cancer (bc) tissues/cell lines; RNA pull‐down, cross‐linking immunoprecipitation (CLIP) assays verified circFut8's interaction with splicing factor SRSF9. CircFut8 overexpression was performed to assess its effects on bc cell proliferation in vitro (CCK‐8, colony formation) and tumor growth in vivo (xenograft models), and its modulation of FUT8 pre‐mRNA splicing was analyzed. Results Here, we identify circFut8—a conserved exonic circRNA originating from FUT8 gene exon 3—as a bc tumor suppressor, which is significantly downregulated in bc tissues and cell lines, correlating with advanced tumor grade and invasion. Mechanistically, circFut8 competitively binds the splicing factor SRSF9, thereby modulating the inclusion/exclusion of exon 3 in FUT8 pre‐mRNA and promoting the production of the FUT8‐4 splice variant. Functional assays confirm that circFut8 overexpression inhibits bc proliferation in vitro and suppresses tumor growth in vivo, while RNA pull‐down and cross‐linking immunoprecipitation (CLIP) assays confirm its direct interaction with SRSF9. Conclusions Our findings unveil a novel circRNA‐mediated regulatory axis wherein circFut8 fine‐tunes pre‐mRNA splicing through competition with SRSF9, suggesting its potential as a candidate for further therapeutic exploration.
Wei-Feng Yang, Lv Yao, Lijun Wan et al.· Journal of Gene Medicine· 0 citations
Recurrent mutations in splicing factors (SFs) have been established as crucial drivers of tumorigenesis in several types of blood cancer and are also common in a variety of solid tumors. Mutations change the RNA-binding preferences of SFs, promote global splicing alterations, and often generate erroneous mRNAs that are then degraded by nonsense-mediated mRNA decay (NMD). Consequently, several critical genes linked to hematopoiesis are dysregulated, leading to blood cancer. Although the field has progressed considerably in identifying aberrant genes and affected pathways, effective therapies have not yet emerged. To address this key gap, we instigated a gene-specific targeted strategy by unlocking the regulatory network. As a proof-of-concept, we scrutinized a tumor suppressor gene, EZH2, which is a bona fide target in SRSF2-mutated cancer. We precisely defined splicing cis-elements in EZH2 transcripts and illustrated the dynamic choreography of regulatory proteins in the entire splicing and NMD catalytic pathways. We then designed antisense oligonucleotides (ASOs) targeting important regulatory sites. Our lead ASO successfully corrects aberrant splicing and NMD, restores the expression and function of EZH2, and partially rescues hematopoietic defects and cellular properties. Our study demonstrates that ASO pharmacology is an actionable strategy for clinical development, challenging the existing paradigms in SF-mutated cancers.
Hypoxia-inducible factor 1-alpha (HIF1A) is a core regulator of cellular adaptation to hypoxic environments and is extensively involved in various cancer processes. Although it is known that HIF1A produces two isoforms, HIF1A-L and HIF1A-S, through the alternative splicing of exon 14, the specific functional differences between these isoforms in cancer development and progression remain unclear, and the molecular mechanisms regulating this exon skipping event have yet to be elucidated. Clinical IHC and FISH analyses demonstrate that HIF1A-L expression is elevated in high-grade breast cancer tissues and correlates with malignant progression. Using transcriptomics and functional assays, we demonstrate that HIF1A-L enhances, while HIF1A-S inhibits, cancer cell proliferation, migration, and invasion. Mechanistically, through luciferase reporter and Western blot analyses, we found that HIF1A-L upregulates CXCR4 to activate the AKT pathway, whereas HIF1A-S antagonizes this axis. Furthermore, via CL-RIP, MS2-RIP, and RNA-pull down assays, we identify the RNA-binding protein HNRNPF as the key upstream regulator that specifically binds to a conserved G-rich sequence (gggaggtggaggttgcgatgagctgagatcagg) within intron 13 of HIF1A pre-mRNA to promote exon 14 retention and HIF1A-L production. Critically, in vivo metastasis assays in nude mice reveal that knockdown of HNRNPF or HIF1A-L suppresses lung metastasis, along with reduced CXCR4 in lung tissues and lower serum levels of the pro-metastatic cytokines IL-6 and CXCL12, whereas knockdown of HIF1A-S exacerbates metastasis. This study elucidates the HNRNPF/HIF1A-L/CXCR4/AKT axis as a central regulatory circuit controlling breast cancer metastasis and suggests that correcting the aberrant splicing of HIF1A may represent a novel therapeutic strategy for cancer.
Mengzhen Huang, Jiang Lei, Wei Wu et al.· Biochimica et Biophysica Act...· 0 citations
Programmed death-ligand 1 (PD-L1) is an immune checkpoint molecule important in tumor immune evasion acting primarily by inhibiting T cell activation. In breast cancer, PD-L1 is frequently abnormally expressed and associated with tumor progression, metastasis, and poor prognosis. Recent studies have revealed that non-coding RNAs (ncRNAs) including microRNAs (miRNAs), long non-coding RNAs (lncRNAs), and circular RNAs (circRNAs) are important post-transcriptional regulators of PD-L1. ncRNAs regulate PD-L1 expression through multiple mechanisms, including direct binding to PD-L1 mRNA 3' UTR, acting as competing endogenous RNAs (ceRNAs), altering transcription factor activity, and altering epigenetic modifications. Dysregulation of ncRNAs not only impact PD-L1-mediated immune escape (i.e., cancer immune evasion), but can also remodel the tumor microenvironment (TME) through impact on immune cell infiltration and activity, and alterations to cytokine production. This review provides an overview of current understanding of ncRNAs regulating PD-L1 in breast cancer, specifically their molecular mechanisms, therapeutic potential, and clinical relevance as biomarkers and/or therapeutic targets. The broad ncRNA-PD-L1 regulatory network is complex, and discoveries in this field may create novel avenues for precision immunotherapy and combination strategies in treating breast cancer.
Amirhossein Mardi, Sajjad Rajabi Moghaddam, Ali Roohi Motlagh et al.· Clinical and Experimental Me...· 0 citations
Immune thrombocytopenia (ITP) is an autoimmune disorder characterized by antibody-mediated platelet destruction and impaired regulatory T-cell (Treg) function, yet its molecular basis remains poorly defined. Here, we show that CD4+ naive T cells from patients with ITP exhibit diminished T-cell receptor (TCR) signaling and impaired in vitro Treg induction relative to healthy controls. RNA-sequencing revealed widespread alternative splicing dysregulation, most notably exon 8 skipping in LCK, a kinase central to TCR signaling and Treg differentiation. Using an LCK minigene combined with RNA pull-down mass spectrometry and RNA immunoprecipitation assays, we identified the splicing factor SRSF1 as a direct upstream regulator of LCK exon 8 skipping. Notably, SRSF1 expression was reduced in CD4+ naive T cells from ITP patients, and its overexpression restored in vitro Treg induction capacity. Antisense oligonucleotide (ASO)-mediated blockade of SRSF1 binding to LCK enhanced exon 8 skipping and attenuated TCR activation in Jurkat cells. Although murine Lck lacks the human-specific recursive splicing sites required for exon 8 exclusion, adoptive transfer of CD4+ naive T cells expressing the exon 8-skipped murine Lck into CD61-knockout mice significantly reduced Treg proportions and platelet counts in an active ITP model. Mechanistically, Jurkat cells engineered to express only the exon 8-skipped LCK variant showed markedly reduced binding to ZAP70 and CD3ζ, which may partly account for the attenuated TCR signaling and downstream FOXP3 induction. Together, these findings define a novel SRSF1-LCK splicing axis that may regulate Treg development in ITP.
Xiang Hu, Shaoqiu Leng, Yan Liu et al.· Blood· 0 citations