Correction: Molecular characterization reveals three Neopestalotiopsis species causing strawberry disease outbreaks in Spain

Abstract

Global strawberry (Fragaria x ananassa Duch.) production is about 10,728,811 tons across 436,067 hectares, with Europe contributing 1,194,930 tons from 75,025 hectares (Faostat, 2024). Among European producers, Spain is a major producer with production of 323,540 tons from 7000 hectares (Faostat, 2024). Geographically, strawberry cultivation in Spain is primarily concentrated in the Southwest region, particularly in Huelva province, which is known for its optimal agroclimatic conditions and sandy, slightly acidic soils that are ideal for strawberry (Medina, 2008). In addition to producing and exporting strawberry fruit, Spain also plays a key role as a major producer and exporter of strawberry transplants, which are cultivated in high-altitude nurseries in Castilla y León (Avilés et al., 2024;Medina, 2008).During the last decade, one of the main problems in worldwide strawberry production has been the emergence of new fungal diseases and the resurgence of existing ones. These issues have been associated with strict regulations regarding the products used for soil disinfestation, frequent changes in cultivars, and the increasing exchange of planting materials, which facilitate the dispersion of plant pathogens (Avilés et al., 2024). This has been the case with Phytophthora cactorum (Lebert and Cohn) J.Schröt. (Baggio et al., 2021a;Baggio et al., 2021b), Macrophomina phaseolina (Tassi) Goid, Colletotrichum acutatum J.H. Simmonds, Fusarium oxysporum f. sp. fragariae Winks and Y.N. Williams (Fof) (Avilés et al., 2008;Borrero et al., 2024;Pastrana et al., 2017;Prieto-Rodríguez et al., 2024;Marin et al., 2025) and Neopestalotiopsis spp. ( Avilés et al., 2024;Baggio et al., 2021a;Rebollar-Alviter et al., 2020).Different Pestalotiopsis-like species, especially Neopestalotiopsis, have been reported in strawberry worldwide as causing fruit rot, leaf spot, root rot, and crown rot.Pestalotiopsis-like species primarily exhibit asexual (anamorphic) stages in their life cycle; however, a sexual stage has been documented in Pinus, Quercus, Rhododendron, and Ricinus spp., among others (Kobayashi et al., 2001;Maharachchikumbura et al., 2014;Shoemaker and Simpson, 1981). In the case of Neopestalotiopsis, conidia are the primary infective propagules (Espinoza et al., 2008). Species in this genus can produce a high number of conidia, which are dispersed in the air or by water splash (Prasannath et al., 2021). Potential sources of inoculum can be contaminated transplants from nurseries (McQuilken and Hopkins, 2004), diseased plant materials (Maharachchikumbura et al., 2011), and over-season strawberry crop debris, as described in Florida (Zuniga et al., 2024). Many species have been isolated as endophytes, but some species can remain quiescent until the plant is stressed and then switch to a pathogenic and necrotrophic lifestyle (Dardani et al., 2025;Liao et al., 2025;Maharachchikumbura et al., 2011). This lifestyle plasticity has been increasingly recognized as a critical factor in the emergence of aggressive Neopestalotiopsis strains in strawberry production systems worldwide, particularly following the widespread outbreaks first documented in Florida in 2018-2019 (Rebello et al., 2023;Ávila-Hernández et al., 2025).The taxonomy of Pestalotiopsis-like species has been confusing since it has undergone multiple reclassifications over the years. Molecular analyses based on the internal transcribed spacer (ITS), translation elongation factor 1-alpha (TEF), and βtubulin (TUB) gene regions, along with morphological characteristics, have been used to differentiate species and clarify phylogenetic relationships. This has led to the reclassification of Pestalotiopsis-like fungi into three genera: Neopestalotiopsis, Pestalotiopsis, and Pseudopestalotiopsis (Maharachchikumbura et al., 2014). The first report of Pestalotiopsis-like fungi causing strawberry fruit rot dates to 1972, whenPestalotiopsis longisetula (Pestalotia longisetula) was identified (Howard and Albregts 1973). More recently, most isolates associated with strawberry foliar, root, and crown rot diseases have been reclassified as belonging to the genus Neopestalotiopsis (Baggio et al., 2021a;Chamorro et al., 2016;Obregon et al., 2018).In Mexico, the causal agent of foliar, root and crown rot disease was identified asNeopestalotiopsis rosae (Rebollar-Alviter et al., 2020). In contrast, isolates from Florida included both N. rosae and a novel phylogenetic group classified as a cryptic Neopestalotiopsis sp., based on analyses of ITS, TEF, and TUB genes (Baggio et al., 2021a). In Florida, N. rosae was primarily found as a secondary pathogen on stressed plants, causing crown and root rot, leading to difficulties in plant establishment, although it could also be isolated from leaves and fruit. However, the more aggressive symptoms on leaves and fruit were mostly associated with the cryptic Neopestalotiopsis sp. (Baggio et al., 2021a). Due to the unresolved taxonomy of Neopestalotiopsis, the term Neopestalotiopsis sp. will be used throughout the manuscript to refer to the cryptic species reported in Florida, strain 17-43 (Baggio et al., 2021a). Beyond Mexico and Florida, Neopestalotiopsis species such as N. rosae, N. iranensis, N. hispanica (syn. N.vaccinii), and N. scalabiensis, have been reported causing similar symptoms in other strawberry-producing countries, including Israel (Kenneth et al., 1968), Brazil (Camili et al., 2002), Egypt (Embaby, 2007), Morocco (Mouden et al., 2014), Iran (Ayoubi and Soleimani, 2016), China (Zhao, 2016), India (Mahapatra et al., 2018), Taiwan (Hsu et al., 2022), Bangladesh (Sultana et al., 2022), Italy (Dardani et al., 2025), and other states in the U.S. such as Indiana (Guan et al., 2023) and Ohio (Rotondo et al., 2023).In Spain, Pestalotiopsis-like fungi were initially associated with strawberry crown and root rot and identified as N. clavispora (Chamorro et al., 2016); however, they were later reclassified as N. rosae (Baggio et al., 2021a). In the same region in Spain, N.clavispora was also found affecting blueberries (Borrero et al., 2018). Before the 2019-2020 strawberry season in Spain, Pestalotiopsis-like fungi were isolated along with other root and crown pathogens, such as Phytophthora cactorum and Colletotrichum acutatum, and were considered opportunistic and secondary pathogens. However, starting in the 2020-21 strawberry season, these fungi were increasingly isolated from necrotic areas in the roots and crowns of weak and stunted transplants. More recently, the fungus has been associated with purple and light to dark brown leaf spots of varying sizes in certain cultivars (Fig. 1A-C). Additionally, Pestalotiopsis-like fungi were isolated from dark purple spots on petioles (Fig. 1D). Under favorable conditions for disease development, particularly when nursery transplants are already quiescently infected, plants exhibit stunted growth, reduced leaf size, and overall diminished development, eventually dying three to five weeks after transplanting. These fungi can also cause significant plant establishment difficulties with great potential to negatively affect yield (Avilés et al., 2024).We hypothesize that multiple genetically distinct Pestalotiopsis-like species are associated with strawberry diseases in Spain, and that their genetic diversity underlies differences in pathogenic potential and epidemiological relevance. Therefore, the main objective of this study are to: (i) characterize genetic variability among isolates using multilocus phylogenetic analyses and sequence-based molecular markers; (ii) evaluate morphology, pathogenicity and agressiveness of representative isolates on strawberry plants using different cultivars; and (iii) integrate molecular and biological data to clarify species boundaries and assess their potential impact on the Spanish strawberry industry. (Sinclair and Dhingra, 1995).DNA was extracted from a single-conidium isolate. In most cases, no differences in colony morphology were observed among single-conidium cultures grown on plates.However, when single-conidium cultures from the same original colonydisplayed distinct morphologies, separate DNA extractions were performed for each morphological type.Extractions were carried out using the HigherPurity TM Plant DNA Purification Kit (Canvax Reagents, S.L., Valladolid, Spain) following the manufacturer's instructions with a modification: a small amount of fungal mycelium (50-100 mg) was scraped from a 7-14 days-old PDA+S plate and placed into a centrifuge tube containing lysis buffer and three to five glass beads. Subsequently, mycelium was homogenized by vortexing in 3 cycles of 7 m/s for 1 minute followed by 30-second rest intervals using a BeadBlaster TM 24 (Benchmark Scientific, Inc, NJ, USA). Genomic DNA was quantified using the Qubit 1x dsDNA HS Assay kit and a Qubit 4 fluorometer (Thermo Fisher Scientific, Life Technologies, Singapore) and adjusted to a final concentration of 5-25 ng/μL. The genomic DNA was then stored at -20°C for future use.López et al 8Polymerase chain reaction (PCR) was used to amplify the partial internal transcribed spacer (ITS) using primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990), the □□-tubulin (TUB) using primers T1 (AACATGCGTGAGATTGTAAGT) (O'Donnell and Cigelnik 1997) and Bt-2b(ACCCTCAGTGTAGTGACCCTTGGC) (Glass and Donaldson 1995), and the translation elongation factor 1-α (TEF) using primers EF1-526F(GTCGTYGTYATYGGHCAYGT) and EF1-1567R (ACHGTRCCRATACCACCRATCTT) (Rehner, 2001). PCR reaction contained molecular grade water, 1× Q5 Reaction Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 200 µM dNTPs, 0.2 U/µL Q5 High-Fidelity DNA Polymerase (New England Biolabs, Inc., Ipswich, MA, USA), 5-25 ng DNA, and 0.5 µM (ITS), 0.4 µM (TUB) or 0.3 µM (TEF) for each primer. Amplifications were carried out in a T100 thermal cycler (Bio-Rad Laboratories, Inc., CA, USA) at 98°C for 30 s, 34 cycles of 10 s at 98°C, 30 s at 55ºC, 56ºC or 58ºC (for ITS, TUB, or TEF, respectively), and 30 s at 72°C, followed by a final extension of 2 min at 72ºC. Negative controls, in which sterile nuclease-free water was added to the reaction mixture instead of a DNA template, were included in the assays.PCR products stained with RedSafe TM (Intro Biotechnology, South Korea) underwent electrophoresis in 1.5% agarose gels run in 1× TAE buffer at 120 V for 25 min and visualized over a UV transilluminator. PCR products were purified and sequenced by StabVida (Caparica, Portugal) using Sanger sequencing.Before phylogenetic analysis, the sequences from the different genes were concatenated to a single alignment using MEGA11: Molecular Evolutionary Genetics Analysis version 11 (Tamura et al. 2021). The reference taxa employed in the phylogenetic analyses were retrieved from GenBank (Table 1). Phylogenetic assumptions, using the concatenated alignment, stationarity (constant nucleotide frequencies over time), and homogeneity (constant substitution rates over time) were assessed using matched-pairs tests of symmetry implemented in IQ-TREE (version López et al 9 2.1.2; Minh et al. 2020;Naser-Khdour et al. 2019). The best-fit substitution model was then determined by ModelFinder considering gene partition according to the Bayesian information criterion (BIC) (Kalyaanamoorthy et al. 2017). For phylogenetic tree construction, partitioned Bayesian inference was performed using MrBayes (version 3.2.7; Ronquist et al. 2012) with the following settings: two independent runs, one million generations, sampling every 1,000 generations, and discarding the first 25% of trees as burn-in. The remaining trees were used for generating a 50% majority-rule consensus tree with posterior probabilities for each node. In addition, maximum likelihood analysis was conducted using IQ-TREE with the same partition scheme and best-fit models.Branch support was based on 1,000 et al. and likelihood et al. The phylogenetic trees were and visualized and using (version and (version analysis of the first the TUB gene was sequenced for the sequences have been GenBank (Table isolates until the strawberry season phylogenetic analyses were initially performed using gene Subsequently, a phylogenetic tree was based on concatenated gene sequences (Fig. The and sequences was to differentiate the phylogenetic tree using TUB sequences was similar to that with concatenated sequences (Fig. Therefore, for isolates from the strawberry season phylogenetic analysis was conducted using TUB sequences (Fig. were for two N. rosae and two Neopestalotiopsis sp. and and two et al 10 and grown in at These isolates were to as each was from a different strawberry and from different across were placed on et al. to were in For each multiple conidia were conidia were for morphological 30 were from conidia in which the were were performed using a to a with version The same isolates used for morphological were for the pathogenicity to