Skip to content
Open access

Transcriptomic and Metabolomic Analysis Following LmRab11A Knockdown Reveals Its Role in Metabolic Regulation and Molting in Locusta migratoria

Aug 2026 · Insects · Vol 17, pp. 803 · 0 citations · 37 references
Medicine

TL;DR

Findings indicate that LmRab11A functions as an important regulatory factor influencing gene expression, metabolic homeostasis, and developmental processes in Locusta migratoria, thereby contributing to normal growth and molting.

Abstract

Simple Summary In our previous study, we found that LmRab11A plays a critical role in the molting process of the migratory locust. To further investigate the function of LmRab11A, in this study, we employed RNA interference (RNAi) to silence the LmRab11A gene, followed by integrated transcriptomic and metabolomic analyses. Transcriptomic analysis combined with RT-qPCR revealed that 9 genes were significantly downregulated following LmRab11A knockdown. Subsequent RNAi-mediated knockdown of these 9 genes showed that silencing only LOCMI11062 (β-tubulin) led to arrested molting and 100% mortality in locust nymphs, a phenotype reminiscent of that caused by LmRab11A knockdown, indicating the essential role of β-tubulin in development. Metabolomic analysis identified 11 significantly altered metabolites, 8 exhibiting decreased abundance and 3 exhibiting increased abundance. Spearman correlation analysis between the 9 downregulated genes and the metabolite suggested potential associations between 6 metabolites and specific genes. Taken together, these findings indicate that LmRab11A functions as an important regulatory factor influencing gene expression, metabolic homeostasis, and developmental processes in Locusta migratoria, thereby contributing to normal growth and molting. This study expands our understanding of the molecular mechanisms underlying LmRab11A function and identifies potential targets for the development of novel locust management strategies.

Read PDF

Similar papers

Open access Jul 2026

Transcriptomic and metabolomic analyses revealed the action mechanism of nesfatin-1 gene on glucolipid metabolism in early development stage of largemouth bass.

Nesfatin-1 has biological roles including the suppression of food intake and the regulation of glucose and lipid metabolisms. However, th8e information available regarding nesfatin-1 in the glycolipid metabolism in the early development stage of fish is still limited. In order to investigate the role of the nesfatin-1 gene in the early development stage of the largemouth bass (Micropterus salmoides), the nesfatin-1 gene was inhibited using siRNA interference technology. Then, we evaluated their mRNA expression levels, transcriptomes and metabolomes. The mRNA expression levels of nesfatin-1 gene were appreciably decreased at 48 h,72 h and 96 h after injection of nesfatin-1 siRNA in the early development stage. The omics results revealed that the nesfatin-1 gene was interfered to induce 1833 differentially expressed genes (DEGs) and 2370 differentially expressed metabolites (DEMs). Bioinformatic analysis enriched the most affected molecular pathways (sphingolipid metabolism, fatty acid elongation, amino sugar and nucleotide sugar metabolism and biosynthesis of unsaturated fatty acids) and metabolic pathways (biosynthesis of unsaturated fatty acids, sphingolipid metabolism and amino sugar and nucleotide sugar metabolism) in early development of largemouth bass. In amino sugar and nucleotide sugar metabolism, increased expression levels of genes such as chic, chs1, and gck genes, alongside decreased expression levels of the chia.1 gene, resulted in significantly elevated concentrations of N-Acetyl-D-glucosamine, beta-d-Fructose 6-phosphate, beta-d-Fructose, D-Mannose 6-phosphate, d-Glucose, d-Glucose 1-phosphate, UDP-glucose, UDP-glucuronate, whilst the concentration of UDP-N-acetyl-alpha-D-glucosamine was markedly reduced. Therefore, the nesfatin-1 gene could influence the early development stage of largemouth bass by affecting signaling pathways associated with glycolipid metabolism. Our findings further expand the molecular mechanisms of nesfatin-1 gene, and provide further theoretical support for the initial breeding and feed adaptation of largemouth bass.

Shiping Su, Xin-Xin Liu, Junqing Li et al. · 0 citations
Jul 2026

Transcriptome and Metabolome Analyses Reveal the Role of FaLEC2 in Regulating Lipid Metabolism in Strawberry.

Lipids are vital cellular components with structural, storage, signaling, and defensive functions, and lipid metabolism is critical to strawberry quality. However, the regulatory mechanism underlying lipid metabolism during strawberry development and ripening remains unclear. Although LEAFY COTYLEDON 2 (LEC2) regulates lipid metabolism, its function in strawberries is unknown. This study explored the role of FaLEC2 in strawberries. FaLEC2 is highly expressed during strawberry development. FaLEC2 overexpression delayed ripening, promoted the accumulation of phosphatidylcholines (PCs), including 1,2-dipalmitoyl-3-sn-phosphatidylcholine (DPPC) and PC (16:0/18:3(9Z,12Z,15Z)), and linoleic acid (LA), upregulated FaLOX2.4/2.5/3, downregulated FaLOX5-like2, and regulated various transcription factors (TFs). Correlation analysis revealed associations among lipid metabolites and multiple regulatory genes. Yeast one-hybrid and dual-luciferase reporter assays preliminarily suggested a regulatory association between FaLEC2 and FaPLA1, identifying FaPLA1 as a putative direct target. These findings indicate that FaLEC2 modulates PCs and LA by regulating lipid-related genes, along with a set of candidate TFs, thereby contributing to the regulation of phospholipid and linoleic acid metabolism in strawberries.

Hongyan Lu, Qiling Yu, Mengyan Li et al. · 0 citations
Open access Jul 2026

Combined transcriptomics and metabolomics reveals the molecular mechanism by which rice responds to Ustilaginoidea virens infection.

Rice false smut caused by Ustilaginoidea virens is a major fungal disease of rice in rice-growing regions throughout the world. However, the key genes and key metabolites related to U. virens resistance in rice remain unclear. Here, we used transcriptomics and metabolomics to determine the gene expression and metabolite accumulation changes in rice at 5, 7, and 9 d after inoculation with U. virens. By comparing the transcriptomes of IR27 (resistant cultivar) and 9311 (susceptible cultivar) spikelets, variable transcriptional responses under control and infection conditions were revealed. In total, 11,235 and 13,453 differentially expressed genes (DEGs) were identified in IR27 and 9311, respectively. The results of Kyoto Encyclopedia of Genes and Genomes and co‑expression analyses showed that the DEGs involved in flavonoid biosynthesis, phenylpropanoid biosynthesis, and plant hormone signal transduction responded to disease resistance. Several WRKY transcription factors were also differentially regulated in the resistant and susceptible cultivars. The metabolome analysis identified 343 and 303 differentially accumulated metabolites in IR27 and 9311, respectively, including salicylic acid, jasmonic acid, gibberellin, d-pantothenic acid, and p-coumaric acid. Many of these are primarily involved in plant hormone signal transduction, phenylpropanoid biosynthesis, and flavonoid biosynthesis pathways. Furthermore, the combined transcriptome and metabolome analysis revealed that plant hormone signal transduction, phenylpropanoid biosynthesis, and flavonoid biosynthesis were significantly enriched in resistant rice varieties. Therefore, these results provide valuable information on the molecular mechanisms by which rice defends against U. virens infection, and they will facilitate the development of disease‑resistant rice cultivars.

Rongtao Fu, Huan Li, Xi Luo et al. · 0 citations
Open access 2026

CRISPRi-mediated knockdown ofmsmeg_6073reveals condition-dependent growth andmorphological phenotypes inMycobacteriumsmegmatis

Background: Tuberculosis remains a major global health challenge, highlighting the need for new therapeutic targets.Mycobacteria can adapt to environmental stress and antibiotic exposure through a potential mechanism calledepitranscriptomic regulation, mainly RNA methylation. Objectives: This study investigates msmeg_6073, the Mycobacterium smegmatis ortholog of the essential Mycobacteriumtuberculosis gene rv3579c, predicted to encode a 23S rRNA 22 -O-methyltransferase involved in ribosomal RNA modification.Methods: Using an anhydrotetracycline (ATc)-inducible CRISPR interference (CRISPRi) system, knockdown strains targetingmsmeg_6073 were constructed. Among designed guide RNAs, guide 1 (5’GGGAAGGCCGCGCCTGCGCACACCG 3’)showed the most consistent functional activity. RT-qPCR analysis confirmed transcriptional repression of msmeg_6073under 50 ng/mL ATc induction conditions. Expression analysis of the upstream gene msmeg_6074 ( cysS ) was also conductedto evaluate target specificity. Phenotypic analysis included ATc-inducible drop assays and liquid culture growth curveanalysis. Results:RT-qPCR analysis confirmed effective transcriptional repression of msmeg_6073 under induced conditions.Furthermore, expression analysis of msmeg_6074 ( cysS) showed no significant transcriptional changes, indicating target-specific repression without upstream gene effects. Phenotypic analysis showed growth inhibition on solid media followingmsmeg_6073 repression, whereas no significant growth defects were observed in liquid culture. These findings suggestthat msmeg_6073 repression may be condition dependent. Conclusion: This study provides a validated CRISPRi workflow for inducible repression of msmeg_6073 in M. smegmatis.Future RNA methylation and MIC analyses may help clarify the role of msmeg_6073 in ribosome-associated processes andsusceptibility to ribosome-targeting antibiotics, improving understanding of the mycobacterial epitranscriptome and itspotential relevance to future therapeutic strategies.

Ali Aadel Karimpour, Suwatchareeporn Rotcheewaphan, Pornchai Kaewsapsak · 0 citations
Open access Jul 2026

Integrated Transcriptomic and Metabolomic Profiling Reveals the Involvement of the miR397-5p–SbLAC14 Module in Condensed Tannin Accumulation in Developing Sorghum Seeds

Sorghum seeds accumulate substantial amounts of condensed tannins (CTs), which are also referred to as proanthocyanidins (PAs), contributing to their characteristic astringent taste. Flavan-3-ol polymers, known as PAs, are sequestered within plant vacuoles and become catalytically activated via laccase enzymes. However, the biological roles and regulatory pathways of laccases in sorghum are still largely unclear. Here, integrated transcriptomic and metabolomic profiling of developing sorghum seeds identified 7942 differentially expressed genes between low- and high-CT lines, with Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment revealing flavonoid biosynthesis as a key pathway; weighted gene co-expression network analysis (WGCNA) further pinpointed SbLAC14 as a hub gene within the module most strongly correlated with CT content. We then examined its regulation by microRNA397 (SbmiR397-5p). Dual-luciferase assays confirmed the binding of SbmiR397-5p to SbLAC14 in co-transformed tobacco leaves. Overexpressing SbLAC14 in transgenic Arabidopsis significantly increased CT accumulation while decreasing catechin and epicatechin levels. Furthermore, transgenic plants overexpressing miR397 (OEmiR397-5p) exhibited reduced CT content, accompanied by a lightening of seed color. Conversely, transgenic lines overexpressing a miR397-insensitive laccase transcript exhibited a reversed phenotypic outcome. Our findings indicate that SbmiR397-5p negatively regulates the expression of SbLAC14 in relation to CT biosynthesis, identifying it as a potential target for manipulating CT metabolism in sorghum. Those results provide a genetic entry point for metabolic engineering and breeding efforts aimed at modulating grain phenolic profiles.

Yannan Shi, Yongchao Guo, Jinping Wang et al. · 0 citations
Open access Jul 2026

Smi-miR164a positively regulates phenolic acid biosynthesis while negatively regulates tanshinone production in Salvia miltiorrhiza

Introduction MicroRNAs (miRNAs) are key post-transcriptional regulators of plant secondary metabolism. Their primary mechanism involves silencing target genes through mRNA cleavage or translational inhibition, which is a major focus of current research in this field. However, the specific regulatory roles of individual miRNAs in coordinating different secondary metabolic pathways in medicinal plants remain largely uncharacterized. Methods This study investigated the roles of Smi-miR164a in Salvia miltiorrhiza. We generated Smi-miR164a-overexpressing (OE-miR164a) transgenic lines and performed comprehensive metabolic profiling and gene expression analysis. Results Overexpression of Smi-miR164a resulted in significant accumulation of phenolic acids, with rosmarinic acid (RA) and salvianolic acid B (SalB) levels increased by up to 2.8-fold compared to wild-type (WT). Conversely, it markedly reduced the accumulation of tanshinones, decreasing tanshinone I (T-I) and tanshinone IIA (T-IIA) to 25-68% of WT levels. Transcriptional analysis showed that expression changes in key biosynthetic genes were tightly correlated with the metabolic alterations. Genes involved in the tanshinone pathway (e.g., HMGR1, DXS2) were downregulated, whereas those in the salvianolic acid pathway (e.g., PAL1, C4H) were upregulated, consistent with the reciprocal accumulation of their corresponding metabolites. Conclusion These findings demonstrate that the Smi-miR164a module acts as a pivotal regulator, positively influencing phenolic acid biosynthesis while negatively regulating tanshinone production in S. miltiorrhiza. This gene presents a promising target for molecular breeding aimed at enhancing the yield of specific bioactive compounds.

Huaqian You, Weibo Jin, Dongfeng Yang et al. · 0 citations